                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAACTGTAATCATTTCTTTTTTTGTATCTTCTTTTGTATCTTCTTTCGTATTTGAT
TTTCCACAAGCACTTAAAAGTAGTGAAAAGGCTAGTAAAAATACAAATACTGTAAACG
ATTTCTTTCGCATGAAATTCATtatgtaccccctacatagtgagaatttttttcaatagcaagcatgataataatacttcatgg
cctcgttgtcaatgaaaataattctcatttccgttgacaatgagaattaagttgaaatacacttacaacgtatcattatacattgaaggggaaacgctgc
ATG

    BCE0684 --- BCE0685 --- BCE0686 Gene: BCE0684     GI: 42779762     BI number: BCE0684     GOG: COG0609     Description: iron compound ABC transporter, permease protein Gene: BCE0685     GI: 42779763     BI number: BCE0685     GOG: COG4779     Description: iron compound ABC transporter, permease protein Gene: BCE0686     GI: 42779764     BI number: BCE0686     GOG: COG1120     Description: iron compound ABC transporter, ATP-binding protei TA G  G A  T A  G A  A A  A TA TA CG A  | CG GC        CG AT       T  C A  A      T  A CG       T  T AT        CG C  A       TA C  |       TA         c TA        TA       c  c TA        AT       c  c TA        GT        at TA       C  C       ta AT       A  A       gc |  A       AT        ta GC        At        at TA        Ta        ta TA        Gt        Tg TA       T  |       At AT        Cg        Cg TA        At        Ta GC        Ta        Tg                         aatttttttcaatagcaagcatgataataatacttcatggcctcgttgtcaatgaaaataattctcatttccgttgacaatgagaattaagttgaaatacacttacaacgtatcattatacattgaaggggaaacgctgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [P] COG4779 ABC-type enterobactin transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here     ..................................................................................................................