                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-17.70 kcal/mol
Antiterminator: Size=65 nt.     Delta G=-10.06 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTTACGATGGATTACGCTGTAGATCCTGCTCGTCAAACAATCGCTGATAGCTGGCC
AAACTCTATTGATGCAACAGCAGCAATGAAAGAGTGGGGCTTTAAAGCAGAATACGAT
TTAGACAAAATGACAACGGACATGCTTGCTAAGTTAAAAAAAAAGCTCACAGCTGAGT
TAGTGATGAATTAAtaggaagggtcgattcttaggaatcgaccttttttgtttgtattttaggaatatacaaataattacaagtgtgata
gaatgaattaatttgtgtgtaaaggggagacagggaATG

    BCE0690 --- BCE0691 Gene: BCE0690     GI: 42779768     BI number: BCE0690     GOG: COG0461     Description: orotate phosphoribosyltransferase domani protein Gene: BCE0691     GI: 42779769     BI number: BCE0691     GOG: -------     Description: mutT/nudix family protei            AG           C  C            AT            CG            TA            CG            GT            AT           A  A           A  G           A  T           A  G           A  A           A  T           A  G AC       A  | A  G       TA C  G       TA A  A       GT GC        AT TA       |  A       ta AT       |  A      t  g |  G       At        cg A  C       Ta        ta AT        Cg        ta AT       G  g       at CG        Ta        gc A  |       Ta        cg GC        Cg        ta AT       G  g       gc TA       T  |       gc TA       A  |       gt TG        Cg        at AT        At        at GT        Gc        gt                         ttgtttgtattttaggaatatacaaataattacaagtgtgatagaatgaattaatttgtgtgtaaaggggagacagggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0461 Orotate phosphoribosyltransferase ... can be seen here     ..................................................................................................................