                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-25.60 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-16.10 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-22.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcttttcattcaaaaaaacatgtagtatactaacttcaaaatcagaggagaaagggagcaaagaactatgcttacttatacaacaattgtagttacattt
gcacaaaaacatcatcatcatacgtaacccttgaaacctagcggaaaaattacgcgtaggtacaagggttattcccgttgtacctacgttaggcgaagag
ccatgtaggtattttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaa
ATG

    BCE0697 Gene: BCE0697     GI: 42779775     BI number: BCE0697     GOG: -------     Description: amino acid permease family protei                       t   a                 t  t t  t        a       t  t t  t      a  g       at gc       g  a       ta gc        cg        gt gc        gc        gc |  g       gc        at at       a  |       ta at       t  |       gc cg        ta        ta at        gt        at ta        cg        cg gc        at        cg gc        ta        gc at        cg        at ta        cg        gc gc        at        at cg        ta        at gt        gt        gt                         ttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-16.10 kcal/mol Antiterminator: Size=36 nt.     Delta G=-22.80 kcal/mol Anti-antiterminator:   Size=49 nt.     Delta G=-22.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tcttttcattcaaaaaaacatgtagtatactaacttcaaaatcagaggagaaagggagcaaagaactatgcttacttatacaacaattgtagttacattt gcacaaaaacatcatcatcatacgtaacccttgaaacctagcggaaaaattacgcgtaggtacaagggttattcccgttgtacctacgttaggcgaagag ccatgtaggtattttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaa ATG     BCE0697 Gene: BCE0697     GI: 42779775     BI number: BCE0697     GOG: -------     Description: amino acid permease family protei   a a  a a  t a  t g  a gc cg gc         a |  g      t  t        a at       t  t      a  g ta        gc       g  a cg        gc        cg cg        gc        gc at       |  g       gc a  a       at       a  | a  |       at       t  | gc        cg        ta ta        at        gt ta        ta        cg cg        gc        at cg        gc        ta cg        at        cg at        ta        cg at        gc        at ta        cg        ta gt        gt        gt                         tttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaaATG     ..................................................................................................................