                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:77 nt.    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:20 nt. Size=69 nt.     Delta G= -3.45 kcal/mol
Anti-antiterminator:    Distance from promoter:10 nt.    Size=46 nt.     Delta G= -3.06 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAA-TAACTT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAAGGGAAAGATATGCCTGATAACTTCTTGAAATTATCAGAAGAGCTATACGAAA
GAATTATAAAAAAAGAAGCAATTGTGAATATATAAtacattctgttcaaaacaaagtatataaaacaaatatat
actttgtttttttatacaaaaatatgtttattttattaaaataatattgtcatagattcggtatacatttataatttttatatattctgaatattcttga
taaaaaggagggggaataTTG

    BCE0706 --- BCE0707 --- BCE0708 Gene: BCE0706     GI: 42779784     BI number: BCE0706     GOG: -------     Description: sodium/alanine symporter family protein Gene: BCE0707     GI: 42779785     BI number: BCE0707     GOG: COG1126     Description: amino acid ABC transporter, ATP-binding protein Gene: BCE0708     GI: 42779786     BI number: BCE0708     GOG: COG0834     Description: amino acid ABC transporter, amino acid-binding protei            AT           A  A            GT            TA            GT            TA            TA            At           A  a           C  c           G  a            At            At            Gc TT        At A  A      A  g A  T      A  t G  A      A  t A  A      A  c A  A      A  a        c A  A      A  a      a  a G  A      T  a      a  a C  A      A  a      a  a A  A      T  c       at T  G      T  a       ta A  A      A  a       at TA       A  a       ta CG       G  |       at GC       A  |       ta A  A      A  |       gc G  A      A  |       at AT       G  |       at AT        Cg        at G  G       At        cg AT        Ta        at CG        At        at TA        Ta        at                         ttttatacaaaaatatgtttattttattaaaataatattgtcatagattcggtatacatttataatttttatatattctgaatattcttgataaaaaggagggggaataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................