                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -5.12 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCTATATGTGAAATCGCTTCTTCTCCGGATTGTGCACATATGCAGTTATATCCAAT
TGGAGTAAGATAAAGCGTTAATAATTCAAGCATTCGCGGTTCATCGTCTACGAGCAGT
ATATCAATCATagagagccctccatatataatttttacttaaattgtaatgcaaaatcatgaagaaatggtgcagattgtaatgcgtctgca
taatttcttcagaattgcttgttattgtaaagttgaaattccattttaggtaatgatattggctcgaaaacgatttatacggaggcggtataGTG

    BCE0720 Gene: BCE0720     GI: 42779798     BI number: BCE0720     GOG: NOG13418     Description: lipoprotein, putativ ac t  t t  t ta ta ta at at tg at ta a  | ta        ag at       a  a cg       g  a c  c       ta t  a       at c  a       cg c  a       tg        aa c  a       at       t  t g  |      |  g      g  g a  |      |  c      t  c g  |      |  a       tg at       |  g       at gc       a  a       gc a  |       at        at Ta        at        cg At        cg        gc Cg        gt        ta Ta        ta        gt                         aatttcttcagaattgcttgttattgtaaagttgaaattccattttaggtaatgatattggctcgaaaacgatttatacggaggcggtataGTG     ..................................................................................................................