                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:174 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -4.11 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCATTAGTGAAGCACCCATTAACAGATCAAGGAATTGAGAAATTCTTAGCTGATTG
GGAAAAAACACAAGAGAAATAAtagaaaatcaagaatcctagtttaattgactaggattcttttttatttaaaagaattttcat
gcaattttgcatattgtcttttaaattttttatataagctatttaatatatatcaaatcactttttatgtttcatatttcgacataaaacggtagaagtt
ctgaccagaaaactggagggcatgattctataacagaaagcttaacgtttatagaattATG

    BCE0739 --- BCE0740 Gene: BCE0739     GI: 42779817     BI number: BCE0739     GOG: -------     Description: hypothetical protein Gene: BCE0740     GI: 42779818     BI number: BCE0740     GOG: COG4412     Description: immune inhibitor A metalloproteas             T AG       A  A G  A      A  A TA       A  t TA       G  a AT       A  g AT       G  a GC       A  a GT       A  a AT       C  a        a A  A      A  t      a  t C  G      C  c      t  t T  |      A  a       tg A  |      A  a       ta GC       A  g       gc AT       A  a       at CG       A  a       ta A  A       At        cg A  T       Gc        cg T  |       Gc        ta T  |       Gt        at AT        Ta        at CG        Tg        gc CG        At        at CG        Gt        at                         ttttatttaaaagaattttcatgcaattttgcatattgtcttttaaattttttatataagctatttaatatatatcaaatcactttttatgtttcatatttcgacataaaacggtagaagttctgaccagaaaactggagggcatgattctataacagaaagcttaacgtttatagaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4412 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:181 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -9.40 kcal/mol Antiterminator: Size=49 nt.     Delta G= -4.11 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G=-11.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTTCATTAGTGAAGCACCCATTAACAGATCAAGGAATTGAGAAATTCTTAGCTGATTG GGAAAAAACACAAGAGAAATAAtagaaaatcaagaatcctagtttaattgactaggattcttttttatttaaaagaattttcat gcaattttgcatattgtcttttaaattttttatataagctatttaatatatatcaaatcactttttatgtttcatatttcgacataaaacggtagaagtt ctgaccagaaaactggagggcatgattctataacagaaagcttaacgtttatagaattATG     BCE0739 --- BCE0740 Gene: BCE0739     GI: 42779817     BI number: BCE0739     GOG: -------     Description: hypothetical protein Gene: BCE0740     GI: 42779818     BI number: BCE0740     GOG: COG4412     Description: immune inhibitor A metalloproteas             t AG       A  a G  A      A  g TA       T  a TA       A  a AT       A  a AT       A  a GC       G  t GT       A  c AT       G  a A  A      A  a C  G      A  g T  |      C  a A  |      A  a GC       C  t        a AT       A  c      a  t CG       A  c      t  t A  A       At        tg A  T       Aa        ta T  |       Ag        gc T  |       At        at AT        Gt        ta CG        Gt        cg CG        Ga        cg CG        Ta        ta                         ttcttttttatttaaaagaattttcatgcaattttgcatattgtcttttaaattttttatataagctatttaatatatatcaaatcactttttatgtttcatatttcgacataaaacggtagaagttctgaccagaaaactggagggcatgattctataacagaaagcttaacgtttatagaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4412 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................