                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=62 nt.     Delta G= -6.45 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGAATGAAATTAATTGCGGTGGATCCATCTGTTATTCCATTAGGATCTACTGTAAA
TGTTGAAGGCTATGGAATTGCAATTGCCGCAGACACTGGTGGCGCGATTAAAGGTCAC
AAAATTGATGTTTTAATGCCTGATAAAGCTTCATCTAGTAATTGGGGCAGAAAAAATG
TTAAAGTTACAATTTTAAACTAAtgcgtaatccaactttacaatatgtaaagttggatttttttgtaaaaataatgttaagtt
gagtttacattttgttaagggtagcatacaatggtggtgagagGTG

    BCE0753 --- BCE0754 Gene: BCE0753     GI: 42779831     BI number: BCE0753     GOG: -------     Description: DNA-binding protein Gene: BCE0754     GI: 42779832     BI number: BCE0754     GOG: -------     Description: conserved hypothetical protei            AC           T  A            TA            GT            AT            AT            AT AT        TA C  C       TA T  T      G  A TA       T  C CG       A  T GT       A  A A  A      A  A A  A      A  t A  T      A  g T  T      A  c        t A  G      G  g      a  a G  |      A  t      a  t TG       C  a       cg CG       G  a       at CG        Gt        ta GC        Gc        ta TA        Gc        ta |  G       Ta        cg A  A       Ta        at A  A      |  c       at TA       |  t       cg TA        At        cg TA        At        ta TA        Ta        at GT        Gc        at                         tttttgtaaaaataatgttaagttgagtttacattttgttaagggtagcatacaatggtggtgagagGTG     ..................................................................................................................