                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTACA-TATATT. It has a score value of 64.93 and is shown in blue

TTTACACCTGTAGCAAATTTATATATTTCGGCATACCCTTTATATGTTGTGTATTTGA
TTTATTTAATTCAAATGACAGTATTCCACATATCTCTATACAGAAATAAATTAGCTTA
Aaaagaagccttcttgcctatgcaagaaggtttctttttagcttatacttgtacatatagcaatattatcttatcattttatatagagtaagattttgta
agggaaaggaattgtatATG

    BCE0755 Gene: BCE0755     GI: 42779833     BI number: BCE0755     GOG: COG3764     Description: LPXTG-site transpeptidase family protei           ta          c  t           cg           gc           ta           ta           cg           ta           ta           cg           cg           gt           at           at           gc             tttttagcttatacttgtacatatagcaatattatcttatcattttatatagagtaagattttgtaagggaaaggaattgtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3764 Sortase (surface protein transpeptidase) ... can be seen here     ..................................................................................................................