                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -6.27 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCATTTTTAATTTTCGTTGGTATTCCGTTAACGTCTAGTATTGCGAATGGAATTGC
AATTGGATTTCTAGTGTATCCAGTCTTAAAAATTGTGAAAGGGAAAGGGATGGAAGTA
CATCCATTACTATACTTATTTACAATTTTATTTGGATGTCATTTATTCTTATAAtatagg
agaggaggcttcttatgaggggctccttttttgtgtataataaagtgaaactataagtagttacgaaaaatataaattacataatggaatatatatgtta
caataaggtggaggtggaacatggATG

    BCE0764 --- BCE0765 Gene: BCE0764     GI: 42779842     BI number: BCE0764     GOG: COG1476     Description: DNA-binding protein Gene: BCE0765     GI: 42779843     BI number: BCE0765     GOG: -------     Description: hypothetical protei             A TT       A  t A  T       Ta T  A       At T  C       Ta C  A       Tg A  A       Cg T  T       Ta        at A  T       Tg       t  g T  T      A  a       ta C  T      T  g       cg A  A       Tg        tg T  T       Ta        tg T  T      A  |       cg AT        Cg       g  | CG        Tg        gc CG        Gc        at TA       T  t       gc AT        At        gc CG        Gc        at AT        Gt        gt                         ttttgtgtataataaagtgaaactataagtagttacgaaaaatataaattacataatggaatatatatgttacaataaggtggaggtggaacatggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1476 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................