                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAATTCTTACTATGATCTACAGTTTCTTCGTTGCAACTGCAACAGTTGGTTTAACTGT
ATGGATCTTCTTCTCAATGTAAtgtacatggaaaagactgctgagattgctcagcagtctttttttattccctcccctattaca
tccacattacggaattaacaacagaatcatgaaaaatatacttattatgacaaatgttaagaaaactctttctttatgaaatcgaatccatatgcgttgc
ttttctacctattatatggctaaataggtactatatttatttgaagggagagaacgcaATG

    BCE0768 Gene: BCE0768     GI: 42779846     BI number: BCE0768     GOG: -------     Description: sodium/hydrogen exchanger family protein/TrkA domain protei AC A  T CG GC         t TA       A  g TA        At GC        Ta |  A       Gc |  G       Ta C  T       At T  T      A  g TG        Cg CG        Ta |  T      C  a       tt |  T       Ta       a  g T  T       Ta        gc TA        Cg        at TA        Ta        gc GC       |  c       ta AT       |  t       cg CG       |  g       gc AT       |  c       ta |  A      |  t       cg |  T      |  g       at TG        Ta        gc CG        Cg        at TA        Ta        at AT        At        at GC        Gt        at                         tttattccctcccctattacatccacattacggaattaacaacagaatcatgaaaaatatacttattatgacaaatgttaagaaaactctttctttatgaaatcgaatccatatgcgttgcttttctacctattatatggctaaataggtactatatttatttgaagggagagaacgcaATG     ..................................................................................................................