                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:95 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.90 kcal/mol
Antiterminator:    Distance from promoter:59 nt. Size=42 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=43 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tgtgct. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttacagacctgatctaggtaatactagcgaagggaagtggagcaacga
ataaattataattttatttgctgtaaccacttcttatttagaagtggttttttatttagatatataaattgaaaggggatagagaaATG

    BCE0795 --- BCE0796 --- BCE0797 --- BCE0798 --- tenI --- goxB --- BCE0801 --- thiG --- BCE0803 --- thiD Gene: BCE0795     GI: 42779872     BI number: BCE0795     GOG: COG0819     Description: transcriptional activator TenA, putative Gene: BCE0796     GI: 42779873     BI number: BCE0796     GOG: -------     Description: ABC transporter, ATP-binding protein Gene: BCE0797     GI: 42779874     BI number: BCE0797     GOG: -------     Description: ABC transporter, permease protein, putative Gene: BCE0798     GI: 42779875     BI number: BCE0798     GOG: -------     Description: ABC transporter, substrate-binding protein, putative Gene: tenI     GI: 42779876     BI number: BCE0799     GOG: -------     Description: regulatory protein TenI Gene: goxB     GI: 42779877     BI number: BCE0800     GOG: COG0665     Description: glycine oxidase Gene: BCE0801     GI: 42779878     BI number: BCE0801     GOG: -------     Description: conserved hypothetical protein Gene: thiG     GI: 42779879     BI number: BCE0802     GOG: COG2022     Description: thiazole biosynthesis protein ThiG Gene: BCE0803     GI: 42779880     BI number: BCE0803     GOG: COG0476     Description: hesA/moeB/thiF family protein Gene: thiD     GI: 42779881     BI number: BCE0804     GOG: COG0351,COG1992     Description: phosphomethylpyrimidine kinas aa t  t g  a        t gc       a  a at       t  a ta       t  t cg        at t  c       at a  g       at g  a       ta ta        at cg        at         t cg        gt       a  t a  g       cg       t  t g  |      a  c       ta a  |       at        cg c  |       cg        ta a  |       gt        ta ta       |  a       cg ta       a  a       at cg        gc        cg |  t       gc        cg cg        ta        at cg        gc        at                         ttttatttagatatataaattgaaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [S] COG1992 Uncharacterized conserved protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.50 kcal/mol Antiterminator: Size=46 nt.     Delta G=-12.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ctttttattacctgatctagattatgctagcgtagggaagcaattcggacactaacaatgagtccccgtttctttgcgtatagaaacggggcttttttat ttgaaaatttcatattgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttacagacctgatctaggtaatactagcgaaggg aagtggagcaacgaataaattataattttatttgctgtaaccacttcttatttagaagtggttttttatttagatatataaattgaaaggggatagagaa ATG     BCE0795 --- BCE0796 --- BCE0797 --- BCE0798 --- tenI --- goxB --- BCE0801 --- thiG --- BCE0803 --- thiD Gene: BCE0795     GI: 42779872     BI number: BCE0795     GOG: COG0819     Description: transcriptional activator TenA, putative Gene: BCE0796     GI: 42779873     BI number: BCE0796     GOG: -------     Description: ABC transporter, ATP-binding protein Gene: BCE0797     GI: 42779874     BI number: BCE0797     GOG: -------     Description: ABC transporter, permease protein, putative Gene: BCE0798     GI: 42779875     BI number: BCE0798     GOG: -------     Description: ABC transporter, substrate-binding protein, putative Gene: tenI     GI: 42779876     BI number: BCE0799     GOG: -------     Description: regulatory protein TenI Gene: goxB     GI: 42779877     BI number: BCE0800     GOG: COG0665     Description: glycine oxidase Gene: BCE0801     GI: 42779878     BI number: BCE0801     GOG: -------     Description: conserved hypothetical protein Gene: thiG     GI: 42779879     BI number: BCE0802     GOG: COG2022     Description: thiazole biosynthesis protein ThiG Gene: BCE0803     GI: 42779880     BI number: BCE0803     GOG: COG0476     Description: hesA/moeB/thiF family protein Gene: thiD     GI: 42779881     BI number: BCE0804     GOG: COG0351,COG1992     Description: phosphomethylpyrimidine kinas   c a  a a  a t  t c  g a  a cg at        cg gc       g  t gc       t  a c  c      t  t t  c       ta t  |       cg a  |       ta a  |       ta cg        ta gt        gc at        cg at        cg gc        cg gt        cg gt       t  | at        gc tg        at gc        gt             ttttatttgaaaatttcatattgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttacagacctgatctaggtaatactagcgaagggaagtggagcaacgaataaattataattttatttgctgtaaccacttcttatttagaagtggttttttatttagatatataaattgaaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [S] COG1992 Uncharacterized conserved protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................