                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:141 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-16.90 kcal/mol
Antiterminator:    Distance from promoter:115 nt. Size=42 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:    Distance from promoter:83 nt.    Size=43 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATT-TATAAT. It has a score value of 88.35 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATTTTTATTATTCTGACGATTATAATGAATGAAAATCAAACAATTCTTATGTTGA
GAAGTGGAGGGACGGGCCCTATGAAACTTCGGCAACCTCGTATGAGACGAAAGGTGCC
AAATCCTGCAGGTGAAGAAACACCTGAAAGATAAgagcggttcaattagtcaagaaggctactcttatttcgata
agagtagctttttttatggctaaaagttaaagggggaataggtaGTG

    BCE1067 --- BCE1068 Gene: BCE1067     GI: 42780143     BI number: BCE1067     GOG: -------     Description: bacterial luciferase family protein Gene: BCE1068     GI: 42780144     BI number: BCE1068     GOG: NOG25627     Description: conserved hypothetical protei             g           a  a           a  a            cg GA        tg A  A       gc A  A       at GC        ta TA       t  | GC       a  | GC       a  |       tc AT       c  |      t  g CG       t  |       ta G  A      t  |       at T  A      g  |       ta C  A      g  |       ta CG       c  |       cg TA        gc        ta AT        at        cg |  A       gc        at A  A       At        ta A  g       At        cg C  a       Ta        gc Cg        At        gt Gc        Gt        at Tg        At        at                         ttttatggctaaaagttaaagggggaataggtaGTG                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................