                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:88 nt.    Distance to gene:14 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-15.00 kcal/mol
Antiterminator:    Distance from promoter:57 nt. Size=40 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=47 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGATA-TACAAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGATATGAAATATGGTTCAATTACAATTGTTGTGCAAGATGGCAAAGTCATTCAATT
AGAGAAAAGTGAAAAAGTACGTTTAAAGTAAaaagcgctgactagaaaaactagaggcggttttaacctatttcatt
aggttaaaaccgtctttttgcttttatagggggaaaaaacATG

    cysH --- sat --- cysC --- nirA --- BCE1548 Gene: cysH     GI: 42780618     BI number: BCE1544     GOG: COG0175,COG5270     Description: phosphoadenosine phosphosulfate reductase Gene: sat     GI: 42780619     BI number: BCE1545     GOG: COG2046     Description: sulfate adenylyltransferase Gene: cysC     GI: 42780620     BI number: BCE1546     GOG: COG0529     Description: adenylylsulfate kinase Gene: nirA     GI: 42780621     BI number: BCE1547     GOG: COG0155     Description: nitrite reductase Gene: BCE1548     GI: 42780622     BI number: BCE1548     GOG: -------     Description: hypothetical protei   T T  A T  A G  A CG AT         a TA       a  a G  A      a  a A  a       gc A  a       at A  a       ta A  g       cg        tc A  |      a  a      t  a Gc       g  |      t  t Tg        tg        at Gc        cg        ta At        gc        cg A  g       cg        cg A  a      g  g       at A  |       at        at G  |       at        ta A  |       at        ta Gc        At        ta At       A  a       ta Ta        Ta        gc Tg        Gc        gc                         gtctttttgcttttatagggggaaaaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0175 3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes ... can be seen here [J] COG5270 PUA domain (predicted RNA-binding domain) ... can be seen here [P] COG2046 ATP sulfurylase (sulfate adenylyltransferase) ... can be seen here [P] COG0529 Adenylylsulfate kinase and related kinases ... can be seen here [P] COG0155 Sulfite reductase, beta subunit (hemoprotein) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987 This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:85 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-21.40 kcal/mol Antiterminator:    Distance from promoter:54 nt. Size=40 nt.     Delta G=-11.30 kcal/mol Anti-antiterminator:    Distance from promoter:18 nt.    Size=55 nt.     Delta G= -4.56 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: CTGATA-TACAAT. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTGATATGAAATATGGTTCAATTACAATTGTTGTGCAAGATGGCAAAGTCATTCAATT AGAGAAAAGTGAAAAAGTACGTTTAAAGTAAaaagcgctgactagaaaaactagaggcggttttaacctatttcatt aggttaaaaccgtctttttgcttttatagggggaaaaaacATG     cysH --- sat --- cysC --- nirA --- BCE1548 Gene: cysH     GI: 42780618     BI number: BCE1544     GOG: COG0175,COG5270     Description: phosphoadenosine phosphosulfate reductase Gene: sat     GI: 42780619     BI number: BCE1545     GOG: COG2046     Description: sulfate adenylyltransferase Gene: cysC     GI: 42780620     BI number: BCE1546     GOG: COG0529     Description: adenylylsulfate kinase Gene: nirA     GI: 42780621     BI number: BCE1547     GOG: COG0155     Description: nitrite reductase Gene: BCE1548     GI: 42780622     BI number: BCE1548     GOG: -------     Description: hypothetical protei   T T  A T  A G  A CG AT TA G  A A  a A  a A  a A  g A  | Gc Tg Gc         g A  |      a  a A  |      t  a A  |       ca        tc A  |       aa       t  a G  |       ga       t  t A  |       tc        at G  |      c  t       ta A  |      g  |       cg T  |       ca        cg T  |       gg        at A  |       aa        at A  |       ag        ta C  |      a  g       ta T  |       Ac        ta T  |       Ag        ta At        Tg        gc Cg        Gt        gc Ta       A  t       cg Gc        At        gt At        At        gc                         tttttgcttttatagggggaaaaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0175 3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes ... can be seen here [J] COG5270 PUA domain (predicted RNA-binding domain) ... can be seen here [P] COG2046 ATP sulfurylase (sulfate adenylyltransferase) ... can be seen here [P] COG0529 Adenylylsulfate kinase and related kinases ... can be seen here [P] COG0155 Sulfite reductase, beta subunit (hemoprotein) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................