                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAATTTATATTTTTTAATGCCATaatacgaattacaaattaatacttatccagagaggtggagggaacggccctatga
aacctcagcaacccctatatatatttataggaaggtgctaattccgcagagaacacgatgtgttttttggaagataagaggattcttgaacgtgaaagaa
aatgacctcttatgtaagaggtcattttttgttgtatagaaagggagtgtcgatgcataattcattttcaaaataaatatagagtaataaaagttgacta
ttaagaggggagaattgtaATG

    BCE2667 --- BCE2668 --- BCE2669 Gene: BCE2667     GI: 42781726     BI number: BCE2667     GOG: COG4720     Description: membrane protein, putative Gene: BCE2668     GI: 42781727     BI number: BCE2668     GOG: COG1122     Description: ABC transporter, ATP-binding protein Gene: BCE2669     GI: 42781728     BI number: BCE2669     GOG: -------     Description: cobalt transport protei   a g  t cg at cg at at gt at gt a  |       cg c  |      a  t gt       a  g cg       g  a cg        ta ta        ta ta        cg |  g       ta |  a       ta        tg |  t      |  a      a  t |  a      |  a       ta a  a      |  t       ta a  g      |  g       cg ta       a  a       ta cg        gc        cg g  g       gc        cg ta        at        at gt        gc        gc |  t       at        ta gc        at        at at        ta        at at        at        at                         tttgttgtatagaaagggagtgtcgatgcataattcattttcaaaataaatatagagtaataaaagttgactattaagaggggagaattgtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4720 Predicted membrane protein ... can be seen here [P] COG1122 ABC-type cobalt transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................