                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:163 nt.    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.10 kcal/mol
Antiterminator:    Distance from promoter:129 nt. Size=49 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:    Distance from promoter:109 nt.    Size=47 nt.     Delta G= -9.59 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tattct. It has a score value of 78.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacattattagttattaactgtattcttcataataacaactaaataaatggaaaaatttattagttttcttattaagagagatggagggactggcccg
atgaaatctcagcaacaggctataaaagtactgtgctaagtccagcaaacgtatgaagcgtttggaagatgaggggaaatggattaacattcaactcttc
ttatatgtgtaagaagagttttttatttagagaggggggatagaGTG

    BCE3547 --- glnQ_lrep_1 --- BCE3545 Gene: BCE3547     GI: 42782597     BI number: BCE3547     GOG: -------     Description: amino acid ABC transproter, permease protein VC0009 [imported] Gene: glnQ_lrep_1     GI: 42782596     BI number: BCE0610     GOG: -------     Description: amino acid ABC transporter-like protein Gene: BCE3545     GI: 42782595     BI number: BCE3545     GOG: -------     Description: Bacterial extracellular solute-binding proteins, family 3 superfamil   g t  a a  a tg gc cg        tt at       a  a at       g  a at        gc cg        ta |  g      a  | |  a       at |  a       at |  g       gc |  a      g  a |  t      g  a |  g       gc |  a       at        tg |  g       gc       a  t |  g      t  t       tg |  g       at        at |  g       gc        ta |  a       at        ta |  a       at        cg g  a      g  a       ta at       g  t       ta cg       t  |       cg cg       t  |       ta ta        ta        cg gt        gt        at at        cg        at                         ttttatttagagaggggggatagaGTG                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................