                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:152 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.50 kcal/mol
Antiterminator:    Distance from promoter:135 nt. Size=32 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:    Distance from promoter:98 nt.    Size=50 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-caaaat. It has a score value of 89.02 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaacatgaaaaatatctgacaaaattcagttatcttaaaaatttaaacatttctaaatacttcttatcaagagcaggtggagggacgagcccgacg
aaacccggcaaccgatctacaattgtagacacggtgctaattctcgcagcattacgctgacagataaggagctggttgtaaaaaaacctctccttagctg
agaggtttttttatttaactaggaggttataacaATG

    BCE4103 --- BCE4104 --- BCE4105 --- BCE4106 Gene: BCE4103     GI: 42783150     BI number: BCE4103     GOG: COG1850     Description: ribulose bisphosphate carboxylase, putative Gene: BCE4104     GI: 42783151     BI number: BCE4104     GOG: COG4359     Description: hydrolase, haloacid dehalogenase-like family Gene: BCE4105     GI: 42783152     BI number: BCE4105     GOG: -------     Description: class II aldolase/adducin domain protein Gene: BCE4106     GI: 42783153     BI number: BCE4106     GOG: COG1791     Description: 5-methylthio-3-oxo-1-penten-1,2-diol dioxygenase, putativ   t t  a a  c cg gc at cg g  a c  c ta         a cg       a  a ta       t  a        a t  t      g  a      t  g a  a       ta       t  c a  a       ta       c  t tg        gc        cg cg        gc        ta g  a      t  t       cg tg       c  |       ta gc        gc        cg gt        at        cg cg        gc        at a  |       gc        at cg        at        at at        at        at gt        ta        at                         ttatttaactaggaggttataacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1850 Ribulose 1,5-bisphosphate carboxylase, large subunit ... can be seen here [E] COG4359 Uncharacterized conserved protein, possibly involved in methylthioadenosine recycling ... can be seen here [S] COG1791 Uncharacterized conserved protein, contains double-stranded beta-helix domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................