                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-26.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGTTGCTCGTGTCGATATCGAAGACGATGAGCTAGATGAAGATGAGTCGATCGAAGA
GGAACGTGATGATCGAAGTGAAGTAGAACAAGGTGAGAATGAGTAAaacaaaggtgcctgtacgtc
tatggacgcgcaggcaccttttttgtcttcaaaaagggaacaagcggcagggagctagtaataacagacttcacatagaattaggtatttttactcaatc
tataagtcctaaaaaagatggacttttctctcttcatctaggtataatggtttaaaagtgtaaaggtgagattaacGTG

    BH0008 Gene: BH0008     GI: 15612571     BI number: BH0008     GOG: COG2206     Description:   A T  A G  a A  a Gc Ta A  a A  a       at G  g      t  g A  g       cg Gt        ta Tg        gc Gc        cg Gc       a  c At       t  g |  g       gc |  t       ta A  a       cg C  c       cg A  g       gc At        ta Gc        gc At        gc Ta        at Gt        at             ttttgtcttcaaaaagggaacaagcggcagggagctagtaataacagacttcacatagaattaggtatttttactcaatctataagtcctaaaaaagatggacttttctctcttcatctaggtataatggtttaaaagtgtaaaggtgagattaacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2206 HD-GYP domain ... can be seen here     ..................................................................................................................