                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTTATATTCAAAAGCCAGATGGTTCGCAAGTGTCAGCGATCAATGAGCTTGACCGA
ATGGATTTTCCAGTGTTGAAAACAGGCGTCAATCACATGGCGATCCGTGCCACCGGAG
AGGCTGATGTCCATGAAGTACAGATGATGTCCCGAAGTCGCTGGCTTTGAggtatgtcaaagg
atgataagaacgctctgccggagagcgttcttatttgatcttggtaagctcgaaaacagctcttcgcaagaagacactagtgaaggaatgagaattttga
ttgtgggaggttgaaaggggcATG

    BH0014 --- BH0015 --- BH0016 --- BH0017 Gene: BH0014     GI: 15612577     BI number: BH0014     GOG: NOG08887     Description: - Gene: BH0015     GI: 15612578     BI number: BH0015     GOG: -------     Description: - Gene: BH0016     GI: 15612579     BI number: BH0016     GOG: -------     Description: - Gene: BH0017     GI: 15612580     BI number: BH0017     GOG: COG3858     Description: CC C  G T  A G  A TG AT         g GC       a  g TG       a  a A  |       at GC        cg AT        ta CG        gt A  |       ta TG       |  a GC       |  g AT       a  a AT        ta GT        gc         c TG       |  g      c  g A  A       gc       g  g Cg        At        ta Cg        Gc        cg |  t      T  t       ta Ta       T  |       cg Gt       T  |       gc Tg        Cg        cg At        Gc        at Gc        Gc        at Ta        Tg        gc                         ttatttgatcttggtaagctcgaaaacagctcttcgcaagaagacactagtgaaggaatgagaattttgattgtgggaggttgaaaggggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3858 Predicted glycosyl hydrolase ... can be seen here     ..................................................................................................................