                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTGCGACTGATAAATGTCGAACGGAAACCCCTGAGCTGCGTACAGCTGACTATATG
AAAGACGGTCATCTCGCCGCATGTCATTACATGGAAGAGATCGAGTCAGGATCTCATC
AGCAGCCTGCTCAAGCATGAtttgcaacgtctctagcagtcgctagaggcttttttttttttgcaaaaatttaattaattctttt
tttaacaatagattaatttattgttacacatcgttggaaatcggctatcttctggtacactagaaaaagatcaccattttaatgaaaggatgaatttttA
TG

    BH0026 Gene: BH0026     GI: 15612589     BI number: BH0026     GOG: COG0737     Description: nucleotidase precurso            tg           t  c AT       t  a C  C      A  a TA        Gc CG        Tg |  C       At        gt T  A      C  |      a  c A  G       Gc        cg GC        At        gc GC       A  c       at AT       C  t       ta CG        Ta        cg T  |       Cg        ta GC        Gc        cg AT        Ta        tg GC        Cg        gc                         ttttttttttttgcaaaaatttaattaattctttttttaacaatagattaatttattgttacacatcgttggaaatcggctatcttctggtacactagaaaaagatcaccattttaatgaaaggatgaatttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0737 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.30 kcal/mol Antiterminator: Size=33 nt.     Delta G= -6.70 kcal/mol Anti-antiterminator:   Size=25 nt.     Delta G= -7.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATTTGCGACTGATAAATGTCGAACGGAAACCCCTGAGCTGCGTACAGCTGACTATATG AAAGACGGTCATCTCGCCGCATGTCATTACATGGAAGAGATCGAGTCAGGATCTCATC AGCAGCCTGCTCAAGCATGAtttgcaacgtctctagcagtcgctagaggcttttttttttttgcaaaaatttaattaattctttt tttaacaatagattaatttattgttacacatcgttggaaatcggctatcttctggtacactagaaaaagatcaccattttaatgaaaggatgaatttttA TG     BH0026 Gene: BH0026     GI: 15612589     BI number: BH0026     GOG: COG0737     Description: nucleotidase precurso            TG           C  C           C  T           G  C   T        AA G  C       CA A  A       GG        gt G  G      A  |      a  c CG        CC        cg TA        TA        gc AT       A  T       at GC       C  G       ta AT        TA        cg GC        Ct        ta A  A       Tt        cg AT        At        tg GC        Gg        gc                         ttttttttttttgcaaaaatttaattaattctttttttaacaatagattaatttattgttacacatcgttggaaatcggctatcttctggtacactagaaaaagatcaccattttaatgaaaggatgaatttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0737 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases ... can be seen here     ..................................................................................................................