                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-11.72 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTTTTAACGATTGAGAATGAGCATCTACGTGAGCGATTAGGGGAGCCTGAACTAGA
AGAAACGGAAGAGAAAGAGCAAGTGACGAAAGAGAGGAAGCCGTTTGTCGGAGAAGGC
TATGATAATCTGGCCCGTCTTTATCAAGAAGGATTTCATATTTGCAATACTCATTACG
GTAGCCTTCGTAAAAACGGAGAAGATTGCCTGTTTTGCCTGTCATTTTTAAATCAAGA
CTAAtgtataaagcgatagccttttcccggtgaaaaggcttttttgctcatgaggagggacttaggtgATG

    BH0047 --- BH0048 --- BH0049 Gene: BH0047     GI: 15612610     BI number: BH0047     GOG: COG4123     Description: - Gene: BH0048     GI: 15612611     BI number: BH0048     GOG: COG2827     Description: - Gene: BH0049     GI: 15612612     BI number: BH0049     GOG: COG0313     Description:             A           T  A           T  A           T  T           T  C           T  A           A  A            CG            TA AA        GC A  A      |  T TA       |  A GC       T  A CG       C  t TG        Cg TA        Gt CG        Ta |  A      T  t |  A       Ta |  G       Ta C  A      G  a GT       T  | AT       C  | TG        Cg GC        Gc GC        Tg |  T       Ta         g CG        At       c  g AT       |  a      c  t T  T      |  g       cg T  T      |  c       ta AT        Gc        ta CG        At        ta T  C       At        ta C  C       Gt        cg AT        At        cg TG        Gc        gc AT        Gc        at                         tttttgctcatgaggagggacttaggtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4123 Predicted O-methyltransferase ... can be seen here [L] COG2827 Predicted endonuclease containing a URI domain ... can be seen here [R] COG0313 Predicted methyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -7.80 kcal/mol Antiterminator: Size=40 nt.     Delta G= -4.49 kcal/mol Anti-antiterminator:   Size=59 nt.     Delta G=-14.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATTTTTTAACGATTGAGAATGAGCATCTACGTGAGCGATTAGGGGAGCCTGAACTAGA AGAAACGGAAGAGAAAGAGCAAGTGACGAAAGAGAGGAAGCCGTTTGTCGGAGAAGGC TATGATAATCTGGCCCGTCTTTATCAAGAAGGATTTCATATTTGCAATACTCATTACG GTAGCCTTCGTAAAAACGGAGAAGATTGCCTGTTTTGCCTGTCATTTTTAAATCAAGA CTAAtgtataaagcgatagccttttcccggtgaaaaggcttttttgctcatgaggagggacttaggtgATG     BH0047 --- BH0048 --- BH0049 Gene: BH0047     GI: 15612610     BI number: BH0047     GOG: COG4123     Description: - Gene: BH0048     GI: 15612611     BI number: BH0048     GOG: COG2827     Description: - Gene: BH0049     GI: 15612612     BI number: BH0049     GOG: COG0313     Description: TA A  A G  T T  C AT        TT TG       A  A CG       C  C GC        TG GC        CG |  C       AT A  G       TA AT       A  G GC       A  | AT       C  | GT       G  |       AA GT       T  |      A  A C  A      T  |       TA T  T      T  |       GC GC       A  |       CG TA       T  |       TG TA       A  |       TA TG       C  |       CG |  A      T  |      |  A G  A      T  |      |  A CG       T  |      |  G CG       A  |      C  A |  A       GC        GT GT        GC        AT AT        AT        TG AT        AT        GC GC        GC        GC                         TGTTTTGCCTGTCATTTTTAAATCAAGACTAAtgtataaagcgatagccttttcccggtgaaaaggcttttttgctcatgaggagggacttaggtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4123 Predicted O-methyltransferase ... can be seen here [L] COG2827 Predicted endonuclease containing a URI domain ... can be seen here [R] COG0313 Predicted methyltransferases ... can be seen here     ..................................................................................................................