                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.72 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTGTTACGAACTTAAAACCAGTGAAGCTTCGTGGTGAGCTTTCACAAGGAATGATC
CTAGCTGGTTCGGAAGGAGATCAATTGCGGTTGGCGACAGTTGATGGAGCATTACCGA
ATGGGTCACTTGTAAAATAGtgcgggtggaagggaggaggactacttctccccttgctttttccaatgggtcaaaaacataaagt
ttttattattataaaatagcgaatatagaggtgtctgtcatgttgtttgatacacatgtccatttaaatgcggaccaattcgatgaggatcaagaggaaG
TG

    BH0054 Gene: BH0054     GI: 15612617     BI number: BH0054     GOG: COG0084     Description:   T T  G G  A AT CG        AT         c A  G      A  A      a  t G  A      A  G      g  a CG        At        gc GC        Tg        at |  A       Gc        gt G  T       Tg        gc T  T       Tg        at TA        Cg        gc GC        At        gc GC        Cg        gc CG        Tg       a  | G  |      G  a      a  | TA       G  a      g  | TA       G  g      g  | AT       T  g      t  | A  G      A  g       gc CG       A  a       gt TG       G  |       gt AT        Cg        cg GC        Cg        gc                         tttttccaatgggtcaaaaacataaagtttttattattataaaatagcgaatatagaggtgtctgtcatgttgtttgatacacatgtccatttaaatgcggaccaattcgatgaggatcaagaggaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0084 Mg-dependent DNase ... can be seen here     ..................................................................................................................