Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-16.80 kcal/mol

                                                                        Nomenclature/Definitions

GCAAGAAGAACTAAAAGGCTGCGTCATTGCACCAATTATTGCAAATGGAGATCCAATC
GGGGCAGTGGTGATCTTTAATAAAGATGAAACATTACAAGGACAAGTGGAACAAAAGC
TGGCAGAAACAGCAGCGAGCTTCCTTGCCCGTCAAATGGAGCAATAAtcacgaagccattctttc
ctcggaaagaatggcttttctactttaagcgattggttggaatccaagttttgctaacaaacgtccaactctatatgtcaacctatggtataatgacaag
aaaaaaaggagaaacgccaATG

    BH0071 --- BH0072 --- BH0073


Gene: BH0071     GI: 15612634     BI number: BH0071     GOG: COG2244     Description: -
Gene: BH0072     GI: 15612635     BI number: BH0072     GOG: COG3956     Description: -
Gene: BH0073     GI: 15612636     BI number: BH0073     GOG: COG1188     Description:


          tc
         c  g
          cg
          ta
          ta
          ta
          cg
          ta
          ta
          at
          cg
          cg
          gc
            ttttctactttaagcgattggttggaatccaagttttgctaacaaacgtccaactctatatgtcaacctatggtataatgacaagaaaaaaaggagaaacgccaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG2244 Membrane protein involved in the export of O-antigen and teichoic acid ... can be seen here
[R] COG3956 Protein containing tetrapyrrole methyltransferase domain and MazG-like (predicted pyrophosphatase) domain ... can be seen here
[J] COG1188 Ribosome-associated heat shock protein implicated in the recycling of the 50S subunit (S4 paralog) ... can be seen here

    ..................................................................................................................