                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:168 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=74 nt.     Delta G=-15.86 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGAAAAGCTTGGGCCAGGTAAAAAAGTAGTAGCCGTCATCCCATCAAATGGAGAGCG
CTACTTGAGCACACCTCTTTATCAATTTGAGGACTAAtaattaggggcagttccagtggcggagctgcctttt
tctatttcaggaaaatctcgtgagtaggtgcttctgatttgcaatttaggctctacaataaatgttggggtttttgcacaaaagagggcaaaaaaaatgc
acgcaggctcctttatccattatccttgaattgtccagaaacaaagaaaggataggagctgcgtgtacgATG

    BH0089 Gene: BH0089     GI: 15612652     BI number: BH0089     GOG: COG3464     Description: transposase (01 CA T  A A  A C  T CG CG TA A  G C  A TG GC C  | CG GC        AA AT       C  T TA       T  T GC        AT AT        TG T  T       TA G  G       TG A  A       CG A  G       TA A  C      |  C A  A      |  T A  C      |  A A  |      |  A TA       |  t       tg GC       |  a      g  g GC       |  a      a  c AT       |  t       cg |  C      |  t       cg |  T      |  a       ta C  T       Cg        tg C  T       Cg        gc G  A      A  g       at GT       C  |       cg GC       A  |       gc TA        Cg        gc TA        Gc        gt                         ttttctatttcaggaaaatctcgtgagtaggtgcttctgatttgcaatttaggctctacaataaatgttggggtttttgcacaaaagagggcaaaaaaaatgcacgcaggctcctttatccattatccttgaattgtccagaaacaaagaaaggataggagctgcgtgtacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3464 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................