                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGCAGCGGGAAGTGGAAGATCGCTTGTCCGAGGAACTTCTCAAAGGAACAATTCAA
AAAGGACAGCGGGCCATTATCGATGTAGAAAACGGCGAATTGGTCGTACATTCGAAAG
AAGGGGCCACACTGTAAggatgaaccatggggatagcatatccccatggttttttgccaaatggcagggatcatattttagaatcggc
ttaaataggatgtaaagtgtagcgaaagcatcggccaacccactaaaagcatgacagtggtacaataaaggtaacaggtttgaaggtgggttgaaaGTG

    BH0104 --- BH0105 Gene: BH0104     GI: 15612667     BI number: BH0104     GOG: COG1066     Description: DNA repair protein Gene: BH0105     GI: 15612668     BI number: BH0105     GOG: COG1623     Description:   c g  a       aa at       a  t ta        cg at        cg gc        gc gc        ta gc       t  | gc       t  | ta       t  | at       t  | cg       t  | cg       g  | at       g  | at       t  | gt       a  | |  t      c  | |  t       cg t  t       cg a  g       cg gc        ta gc        at             catattttagaatcggcttaaataggatgtaaagtgtagcgaaagcatcggccaacccactaaaagcatgacagtggtacaataaaggtaacaggtttgaaggtgggttgaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1066 Predicted ATP-dependent serine protease ... can be seen here [R] COG1623 Predicted nucleic-acid-binding protein (contains the HHH domain) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-18.80 kcal/mol                                                                         Nomenclature/Definitions ATTGCAGCGGGAAGTGGAAGATCGCTTGTCCGAGGAACTTCTCAAAGGAACAATTCAA AAAGGACAGCGGGCCATTATCGATGTAGAAAACGGCGAATTGGTCGTACATTCGAAAG AAGGGGCCACACTGTAAggatgaaccatggggatagcatatccccatggttttttgccaaatggcagggatcatattttagaatcggc ttaaataggatgtaaagtgtagcgaaagcatcggccaacccactaaaagcatgacagtggtacaataaaggtaacaggtttgaaggtgggttgaaaGTG     BH0104 --- BH0105 Gene: BH0104     GI: 15612667     BI number: BH0104     GOG: COG1066     Description: DNA repair protein Gene: BH0105     GI: 15612668     BI number: BH0105     GOG: COG1623     Description:            c          g  a           at           ta           at           gc           gc           gc           gc           ta           at           cg           cg           at             tttttgccaaatggcagggatcatattttagaatcggcttaaataggatgtaaagtgtagcgaaagcatcggccaacccactaaaagcatgacagtggtacaataaaggtaacaggtttgaaggtgggttgaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1066 Predicted ATP-dependent serine protease ... can be seen here [R] COG1623 Predicted nucleic-acid-binding protein (contains the HHH domain) ... can be seen here     ..................................................................................................................