                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAGCTCCAATTAAAGAAGGCGTAGCGAAAGAAGAAGCTGAAGAAATGAAAGCGAAGC
TTGAAGAAGCAGGTGCTTCTGTAGAGCTTAAGTAGtcataattagcaaaaagaggctcgcgatatcgcgggtct
ttttttccacttcttttaaaaacgttacgtctttgcttgataagtaggctctacaataaatgttggggtttttgcacaaaagagggcaaaaaaaaatgca
cgcaggctcctttatccattatccttgaattgccgagaaacaaagaaaggataggagctgcgtgtacgATG

    BH0123 Gene: BH0123     GI: 15612686     BI number: BH0123     GOG: COG3464     Description: transposase (01 GG A  T CG GC AT AT        aa GC       t  t AT       a  t |  G      c  a A  T       tg G  A       Gc TG       |  a TA       A  a CG       T  a GC       G  a AT       A  a       ta AT       A  g      a  t |  A       Ta        gc G  A       Tg        cg CG        Cg        gc GT        Gc        cg A  A       At        tg A  G       Gc        cg At       A  |       gt Gc        Tg        gc Ta        Gc        at At        Tg        gt                         tttttccacttcttttaaaaacgttacgtctttgcttgataagtaggctctacaataaatgttggggtttttgcacaaaagagggcaaaaaaaaatgcacgcaggctcctttatccattatccttgaattgccgagaaacaaagaaaggataggagctgcgtgtacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3464 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................