                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATCAAGAGAAACGCCTTTGGCTTTCGGCGTTATGATCGCCTACGAAACCGTATTCT
ATTACATCATCAATTCAAACATCAGACATTCGGGGTAGGATAAgagggtctcgccctcctatgccacc
ccaacatttgactaagaaccgataagtataaatgatcgcttccgctagtaaatagtggcggcaagtcgagtttttttaagactatcatgaaacttaatct
gatgaacggacctgataggcttcggtgcatggattgacttataggtgggaataggaataggagggggtggcgtaATG

    BH0124 Gene: BH0124     GI: 15612687     BI number: BH0124     GOG: COG2813     Description:   t a  a t  a g  a       aa a  t      a  t a  g      t  a ta       g  g at        at gc        tg cg        cg c  c       gc at        cg at        cg gc       |  c |  c       ta |  g       ta a  c       cg at       |  t ta        gc cg        cg at        ta             gtttttttaagactatcatgaaacttaatctgatgaacggacctgataggcttcggtgcatggattgacttataggtgggaataggaataggagggggtggcgtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG2813 16S RNA G1207 methylase RsmC ... can be seen here     ..................................................................................................................