                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGTAAGAAATACGGTCTTAAAGCCGCTCGTCGTGCACCTCAGTTCTCAAAACGTTA
Atatcaatgatttacagaaccctctgctttccaacccggcagagggttttttaatgttgcactcgttaataagtctgtagcttgctactttgcattcaga
gtgtaccgacgatgagtgagtttttaaatataggtaaatataacacatgaaacaaaccctttgacaagcggcaaaacattttatacgatacatgttgtta
cgtagaaaataattctgataagaatagtgggggtttatgacaATG

    BH0170 --- BH0171 --- BH0172 Gene: BH0170     GI: 15612733     BI number: BH0170     GOG: COG0834     Description: amino acid ABC transporter (amino acid-binding protein) Gene: BH0171     GI: 15612734     BI number: BH0171     GOG: COG0765     Description: amino acid ABC transporter (permease) Gene: BH0172     GI: 15612735     BI number: BH0172     GOG: COG1126     Description: amino acid ABC transporter (ATP-binding protein            ta           A  t           A  c            Ta            Ta            Gt            Cg           A  a            At            At            At           |  a        a           C  c      c  a ac        Ta       c  c g  a       Cg       t  c tA        Ta       t  c aT        Ta        tg tG        Gc        cg tG       A  c       gc t  C      C  c       ta g  A      T  t       cg gC       C  c       ta gC       C  |       cg gT        At        cg gC        Cg        cg tA        Gc        at                         tttttaatgttgcactcgttaataagtctgtagcttgctactttgcattcagagtgtaccgacgatgagtgagtttttaaatataggtaaatataacacatgaaacaaaccctttgacaagcggcaaaacattttatacgatacatgttgttacgtagaaaataattctgataagaatagtgggggtttatgacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here     ..................................................................................................................