                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G=-13.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGAAGGAATGACCATGATCGTTGTCACCCATGAAATGAGGTTTGCCCAAGAAGTGG
CGGACGAAGTCATTTTTATGGATGACGGCAAAATTGTGGAGCGAGGCACCCCAGACGA
CATCTTCAAGACACCAAAAGTAGAGCGGACGAAGCAGTTTCTTCGTCTCATTCATAGT
AGAGTGTAAcgaaataaggcgaagaagaacccctgctgcagaacgagtgtcgcaggggtttttgatcgttttcatgataatatgaaaccactgt
ttaaaatgacagcatagaggagtggcgaacgaATG

    BH0173 Gene: BH0173     GI: 15612736     BI number: BH0173     GOG: -------     Description: GT A  T C  T GC AT AT GC CG AT GC GT |  C       ta C  A      a  a GT       a  g AT       a  g GC        gc A  A       cg T  T      |  a G  A      |  a A  G      |  g        c A  T      A  a      a  g A  A      A  a      a  a A  G      T  g      g  g C  A      G  a       at CG        Ta        cg AT        Gc        gt CG       |  c      t  c AT       A  c       cg G  A       Gc        gc A  A       At        ta A  c       Tg        cg Cg        Gc        cg Ta        At        cg Ta        Tg        cg                         tttttgatcgttttcatgataatatgaaaccactgtttaaaatgacagcatagaggagtggcgaacgaATG     ..................................................................................................................