                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -4.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCGCAAATCGTAAGAAGCATGGCGAAGCGCTATGATACAGATGTTGGCCCATGGAA
GGAATACTTAGGCATCTTAAACGATTAAacaattcagagcccttgatcgattgatttgatcaagggttttctatctttc
taccatttttacaaaataaatgggataaagaagtcaaaaacgggtatagagtacacgatgcgcgtctcgttttagttgaaatgattaggaaagggggatc
agtcatcgccaactggcggaatcgaggcgaacgaagcaattgattcaaggggaggatttctttATG

    BH0185 Gene: BH0185     GI: 15612748     BI number: BH0185     GOG: COG0402     Description: ca t  g t  a a  g a  c c  c        g a  c      t  a At       t  t At        at Tg        gt Ta        cg At        ta Gc        at Cg        gc A  a       ta At        ta At        cg Tg        cg Ta        cg             ttttctatctttctaccatttttacaaaataaatgggataaagaagtcaaaaacgggtatagagtacacgatgcgcgtctcgttttagttgaaatgattaggaaagggggatcagtcatcgccaactggcggaatcgaggcgaacgaagcaattgattcaaggggaggatttctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [FR] COG0402 Cytosine deaminase and related metal-dependent hydrolases ... can be seen here     ..................................................................................................................