                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCCCCATTCCCTGGAAAGGAATGGGCGACCACAATACATTATATGTCAAGTGGGCAA
CTGAACGTAGCACCGATGATCTCGTATCGCCTTCCTCTAGCCAAAGGTCCCGAGACAT
TTCAGCAAATAGCTAAAGGGGAACTGAAACCGACAAAAGTATTGTTTTACCCAGAAAA
ACTGTCTGAGAGGAAGTAGcacttcctctcctctcttttatgacaagatttttgtaaccgaacacgaggatgatcaactatacttt
acataagcaattgtcatttttaaaaagagaggggtttaggATG

    BH0186 Gene: BH0186     GI: 15612749     BI number: BH0186     GOG: -------     Description: AA A  A CG AT         A |  A      A  A G  T      A  A C  T       GC CG        AT         G AT        CG       A  c AT       C  T      T  a AT       C  C       Gc GT        AT        At TA        TG        At C  |       TA        Gc A  |       TG        Gc A  |       TA        At GC       G  G       Gc GC        TG        At GC        TA        Gc                         ctctcttttatgacaagatttttgtaaccgaacacgaggatgatcaactatactttacataagcaattgtcatttttaaaaagagaggggtttaggATG     ..................................................................................................................