                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATCTGTCTTTGCAGAGGGCAACTCTCTAGTAAAAAAGGATAAGGAATACAATTT
CCTTGACCATCCGTTTATGTCCGAAAGCCAATCATAGccaaggtgcactcattttttatgccgtagcctaaag
tagggttacggttttttctattgaaagtaggattcattagccctactcaagacatatgacataaatagatcacaatgatgtacattagatgaccaacaaa
ttaagatgaaagcgcatccaaaatcgatttggcgtgtgctagaatcggaaccaagaaagagggaggtctATG

    BH0193 --- gatA --- gatB Gene: BH0193     GI: 15612756     BI number: BH0193     GOG: COG1762,COG3711     Description: - Gene: gatA     GI: 15612755     BI number: BH0192     GOG: COG1762     Description: PTS system, galactitol-specific enzyme II, A component Gene: gatB     GI: 15612754     BI number: BH0191     GOG: COG3414     Description: PTS system, galactitol-specific enzyme II, B componen   t t  t t  t ta        ag at       a  t cg       a  a |  c       tg t  c       cg cg        cg at        gt c  a       at g  |       ta tg        gc gc        cg gc        cg at        gt             tttttctattgaaagtaggattcattagccctactcaagacatatgacataaatagatcacaatgatgtacattagatgaccaacaaattaagatgaaagcgcatccaaaatcgatttggcgtgtgctagaatcggaaccaagaaagagggaggtctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here [K] COG3711 Transcriptional antiterminator ... can be seen here [GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here [G] COG3414 Phosphotransferase system, galactitol-specific IIB component ... can be seen here     ..................................................................................................................