                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCTTTAATTGTTGTCTACCAACAGGGTTACATAGCAGAAGCGTTAGTTGCGCGTGCC
ACTCCACTTGCAATTGTTGTTGGATTATCTGCGATAGCGGCGGCGATCATTGTGAAAA
AATAGtggagcagagtacgattaatcaaaaggcgtgacttcagaaggagttgtgtttttttgtgcttctcattgaatctctatcaatcgagattgta
gtttgccaatgtttaatcagaatgattcactgcatcaactcgtgtatggttgagagaaagaagcatagagaaggatggaggaagccgATG

    BH0235 Gene: BH0235     GI: 15612798     BI number: BH0235     GOG: -------     Description:            tc           a  a           a  a            ta            ta           |  g           a  g AA        gc        ga A  A       cg       a  a G  A       at        cg TA        tg        tg GT       g  a       ta TA       a  |       cg TG       g  |       at At       a  |      g  t Cg       c  |      t  g Tg        gc        gt A  a       at        cg G  |       gt        gt Cg        gc        gt Gc        ta        at                         ttttgtgcttctcattgaatctctatcaatcgagattgtagtttgccaatgtttaatcagaatgattcactgcatcaactcgtgtatggttgagagaaagaagcatagagaaggatggaggaagccgATG     ..................................................................................................................