                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -4.72 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAAGTGAACAATGGTCAACAACTCAATTATCGGATGACCGAACGGAACGGAGAATGG
GAACGGGTTGTCGAGAATTTATCGAGCGGCGATGTACTTGAATATAGCTTCACGTATG
AAAAGCTCGGACCCCAATATACGACTGAATGGTTTACGTATTCGCGTTAAtgaaatagtggat
ggagctgcccgttgatgcagctccttttatcgttatgattcatccccacatttgttcacaaaatctaacgacttcgattgggttgattttacgttataat
gtaaaaaagaggggatttatgATG

    BH0237 Gene: BH0237     GI: 15612800     BI number: BH0237     GOG: COG0477     Description: multidrug-efflux transporte CA C  A C  T C  A A  T       tg G  A      A  a GC       A  a CG       T  a TA       T  t C  |      G  a GC        Cg AT        Gt |  G       Cg |  A       Tg        tt |  A       Ta       g  g A  T       At       c  a A  G       Tg       c  t A  G      G  g       cg G  T      C  a       gc T  T      A  g       ta AT       T  c       cg TA       T  t       gc GC        Tg        at CG        Gc        gc AT        Gc        gc                         ttttatcgttatgattcatccccacatttgttcacaaaatctaacgacttcgattgggttgattttacgttataatgtaaaaaagaggggatttatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................