Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:139 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.51 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGTGTTGTCACCGAACTTTTAGGCGTTCCTTTTATCGTTAGTGGGTGCTTGATGCTT
GGGTGCAGCGTGCTTTTAGTTTGGCTATCGCAAAAAAGGATCACCGAGTCTTATGCTG
TAAAAAGAGGTGCTTAAaccatctggcttttcaggtggttttttcttatgacattaaagagaaaaaagattgcggaaaagcgaacttc
ccgaacaagaaatttgtccaaaagctgtcttgatttccactgcatgagccccgcggttcctctggatactaaagaaaaaagggagtgtgaggagcgATG


    BH0238


Gene: BH0238     GI: 15612801     BI number: BH0238     GOG: NOG14037     Description:


           TT
          C  A
          G  A
           Ta
           Gc
           Gc
          |  a
           At
           Gc
           At
  A       A  |
A  A      A  |
A  A      A  |
C  A      A  |
G  G      T  |
 CG       G  |       tt
 TA       T  |      c  t
 AT       C  |       gt
T  C      G  |       gc
C  A      T  |       ta
 GC       A  |       cg
 GC       T  |       tg
 TG       T  |       at
 TA        Cg        cg
 TG        Tg        cg
|  T       Gc        at
 GC        At        At
 AT        Gt        At
                        tttcttatgacattaaagagaaaaaagattgcggaaaagcgaacttcccgaacaagaaatttgtccaaaagctgtcttgatttccactgcatgagccccgcggttcctctggatactaaagaaaaaagggagtgtgaggagcgATG


    ..................................................................................................................