                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.90 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agagcaatcggctgttaaccgatcggtcgtaggttcgagtcctacctgtggagccatttttttgcttccatagctcagtcggtagagcactaccatggta
aggtaggggtcagcggttcaagtccgcttggaagcttagcagaatacgggtaaggttggagtttctccgataatggggaagcttattttttgtgtttcgg
ttttttgctttcaggataggtcaagatcgatcactctcatttttgagtttaaggattaatcaaacgtttaattaatgcctctcgtttggctctacaataa
ATG

    BH0245 Gene: BH0245     GI: 15612808     BI number: BH0245     GOG: COG3464     Description: transposase (01 cg a  g tg at a  a g  a                 ta a  g                a  a cg                 g  t gt                  cg at         t        cg |  g      t  t       tg tg        gc        cg ta        at        ta cg        gc        ta gt        gc        tg at        tg        gc at        ta        at gc        gt        gt                         attttttgtgtttcggttttttgctttcaggataggtcaagatcgatcactctcatttttgagtttaaggattaatcaaacgtttaattaatgcctctcgtttggctctacaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3464 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................