                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=2 nt.   Size=17 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -3.20 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcttgtagcgagctttgatgaagaagggtaacttgcagaataggtttataaaaggtggaagaaactacagagaatgcaaagaaccgcttcctctttagaa
aatgtgttataatagacatactgccttgcgaaatgcaaggacttttcttttccaatagatccgtaatcacttttgttaacaagtaagacgaagtaacttt
gaatggatacgatgccttgcaacctgaggcacgtaacgtagatgtttcactttatcaactgagctcgaatgaattgtaaaaatggtttggaggaaagacc
ATG

    BH0265 --- BH0266 --- BH0267 Gene: BH0265     GI: 15612828     BI number: BH0265     GOG: COG1624     Description: - Gene: BH0266     GI: 15612829     BI number: BH0266     GOG: COG4856     Description: - Gene: BH0267     GI: 15612830     BI number: BH0267     GOG: COG1109     Description: phosphoglucosamine mutas            aa           t  t           a  a            tg            ta            gc            ta            gt            ta           a  | ga       a  | a  a      a  | a  c      a  | a  c       gc cg        at gc        tg t  t      t  c a  t      t  c a  c      c  t        a gc       t  t      a  a at       c  |      g  t gc       c  |       cg at       t  |       gc c  t      t  |       ta at        cg        ta ta        gc        cg cg        cg        cg                         acttttcttttccaatagatccgtaatcacttttgttaacaagtaagacgaagtaactttgaatggatacgatgccttgcaacctgaggcacgtaacgtagatgtttcactttatcaactgagctcgaatgaattgtaaaaatggtttggaggaaagaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1624 Uncharacterized conserved protein ... can be seen here [S] COG4856 Uncharacterized protein conserved in bacteria ... can be seen here [G] COG1109 Phosphomannomutase ... can be seen here     ..................................................................................................................