                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGCTGCGCTACACCGTGGTTGTGACGTAGATAAGCCACGAAACCTTGCGAAGAGTG
TGACGGTGGAGTAGgtcggttttatagtttgacttggtgattgtagatttgaaataaagttgcgacgttttacccctttggatatgatta
gccaaaggggttttttattagcgattttgaaaacccctggctatgccaggggttccagaaagcttttagcgtggtaaaaaaatcctcgcttcatggtaag
ataaagtaggtttcccgaccgcaccatctcaccatagaaggaggattgcccaATG

    BH0269 Gene: BH0269     GI: 15612832     BI number: BH0269     GOG: COG1943     Description: transposase (09   a t  t t  a t  g t  t gt gt cg ta        aa gc       a  t Gt       g  a At        ta Tg        ta G  g       tg A  t       at        ga G  g       gt       t  t G  |      |  g       at Ta       |  c       ta Gt       a  g      a  g Gt        ta        gc Cg        gc        gc A  |       tg        ta Gt       |  t       ta Ta       t  t       ta G  g       at        cg Ta        gt        cg Gt        ta        cg At        gc        cg Gt        gc        at                         tttttattagcgattttgaaaacccctggctatgccaggggttccagaaagcttttagcgtggtaaaaaaatcctcgcttcatggtaagataaagtaggtttcccgaccgcaccatctcaccatagaaggaggattgcccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1943 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................