                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:185 nt.    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-13.30 kcal/mol
Antiterminator:    Distance from promoter:155 nt. Size=45 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:    Distance from promoter:118 nt.    Size=48 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgatt-tacact. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgatttaattgtagtgtagtaatacactttaataggcttcttaggtgcctcatttgtaggagaatagggaagttctgaaacgacgcggagcccgccact
gtagtcgaggagctgctacaataccactgggaaactgggaaggtgtagcatgcgatgaatcggagccaggagacctgcctaagaagatgcgctgtcattg
atgaggcatggcataccctcagcttatttaagctggggttttttgtgtggtcgggagttaccgtcaaaggaggaaggatcATG

    BH0284 Gene: BH0284     GI: 15612847     BI number: BH0284     GOG: COG2038     Description: nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferas   g a  a gc        ca gc       g  t at       g  g cg       a  g c  c       gc gc        ta at        at g  a      g  a g  a      t  c cg       t  c ta       a  c       tt a  a      c  t      a  t a  g      t  |       ta g  a       gc        ta t  t       ta        cg a  g       cg        gc gc        gc        at cg       c  t       cg gc        gt       t  | t  |       ta        cg at        at        cg cg        gt        cg gt        at        at                         tttttgtgtggtcgggagttaccgtcaaaggaggaaggatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2038 NaMN:DMB phosphoribosyltransferase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................