Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:164 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cttatcaactgtgggtgacgattaatacattagaagttgtcacttgaagggtcgttttaaaatcgaatgattcgagcagatatgcttaaaagaatggtct
cttaggacaggatgtttctatgaggccgtttttttattgtaagctctatagcgtaaatctttaagaatattagatcaacccttccgttttccttacatta
ggtgtaagtgtttttcgtctgtcatactggttaaaatgtgaatagctccatccggtggatgatgatttccgaaaatgatgatagaaaaggggagtttcac
ATG

    BH0286 --- BH0287 --- BH0288 --- BH0289


Gene: BH0286     GI: 15612849     BI number: BH0286     GOG: COG1136     Description: ABC transporter (ATP-binding protein)
Gene: BH0287     GI: 15612850     BI number: BH0287     GOG: COG0577     Description: -
Gene: BH0288     GI: 15612851     BI number: BH0288     GOG: COG0745     Description: two-component response regulator
Gene: BH0289     GI: 15612852     BI number: BH0289     GOG: COG0642     Description:


  a
t  a
t  a
t  a
t  t
 gc                  ga
 cg        at       g  t
 ta       g  a      a  g
|  a       at       c  t
g  t       cg        at
g  g       gc        gt
g  a       at        gc
 at        gt        at
 at       |  a       ta
 gc       |  a      t  t
 tg       |  a       cg
 ta       |  a       ta
 cg        cg        cg
|  c       ta        tg
a  a       ta        gc
 cg        at        gc
 ta       g  g       tg
 gt        tg        at
 ta        at        at
                        tttttattgtaagctctatagcgtaaatctttaagaatattagatcaacccttccgttttccttacattaggtgtaagtgtttttcgtctgtcatactggttaaaatgtgaatagctccatccggtggatgatgatttccgaaaatgatgatagaaaaggggagtttcacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here
[V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here
[TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here
[T] COG0642 Signal transduction histidine kinase ... can be seen here

    ..................................................................................................................