                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCAGAAGGAAGCTTGCCAGGTGATCGGGAGGATCGAAGCGACAAGATGGGGCGGTCG
AATTCGGAAGAACTTAGATACAAAAACGCCGACCATATTTATGATGAATATTAAgttcag
catgatttgacgaagaggaatccattttgagcaacaatttcaaaatgggttctttctatattttttacgtagtgttttttgttttactccaatatgaccg
tttgcataagtgtatgataggatggataatgaagtaaaaattaggatcgtaaaaagaaaatataaccactaaggagctcatgATG

    BH0299 --- BH0300 Gene: BH0299     GI: 15612862     BI number: BH0299     GOG: COG0456     Description: - Gene: BH0300     GI: 15612863     BI number: BH0300     GOG: -------     Description:   T T  A A  A Tg         a At       g  a At       c  g Gc       a  a Ta       g  g A  g       tg Gc        ta         c Ta        ta       a  a At        at       a  a Tg       |  c      c  t Ta        gc        gt T  t       ta        at A  t       at        gc T  |      c  t       ta At        gt        ta Cg        at        ta C  a       cg        ta A  |       ta        at Gc        tg        cg Cg        gc        cg                         gttctttctatattttttacgtagtgttttttgttttactccaatatgaccgtttgcataagtgtatgataggatggataatgaagtaaaaattaggatcgtaaaaagaaaatataaccactaaggagctcatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0456 Acetyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.60 kcal/mol Antiterminator: Size=38 nt.     Delta G= -5.50 kcal/mol Anti-antiterminator:   Size=23 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCCAGAAGGAAGCTTGCCAGGTGATCGGGAGGATCGAAGCGACAAGATGGGGCGGTCG AATTCGGAAGAACTTAGATACAAAAACGCCGACCATATTTATGATGAATATTAAgttcag catgatttgacgaagaggaatccattttgagcaacaatttcaaaatgggttctttctatattttttacgtagtgttttttgttttactccaatatgaccg tttgcataagtgtatgataggatggataatgaagtaaaaattaggatcgtaaaaagaaaatataaccactaaggagctcatgATG     BH0299 --- BH0300 Gene: BH0299     GI: 15612862     BI number: BH0299     GOG: COG0456     Description: - Gene: BH0300     GI: 15612863     BI number: BH0300     GOG: -------     Description:             g           t  a           a  t           c  t           g  t            ag         c            ca       a  a            tc       a  a   T        tg       c  t T  A      |  a       gt A  A       ga        at Tg        Ag        gc At        Aa        ta At       T  g       ta Gc        Tg        ta Ta        Aa        ta A  g       Ta        at Gc        At        cg Ta        Ac        cg At        Gc        tg                         ttctttctatattttttacgtagtgttttttgttttactccaatatgaccgtttgcataagtgtatgataggatggataatgaagtaaaaattaggatcgtaaaaagaaaatataaccactaaggagctcatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0456 Acetyltransferases ... can be seen here     ..................................................................................................................