                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAAGGGTGTTTCAGCCATTTTTAATCAATTGGAGAGTGCTGTTCAGGAAACAGAGG
AATAGaaATGGAAAACGGTTGGAGAGAGAGAAAAGCTCTCGGGGACAGGAAGCAGACT
ACATTCGTTTGGCGACTAGCATCAGAAGCCGAGCGAATGTTTTTTTCTTATGCATGGA
TCTTACGTTTTATAAGCAGTATTATTGAAAGTATATTTGAAAATGATTATCATTATTA
AtaacgttttcgtaaatttggttgttctacatgaagccattgaatgacgaaaaaaggagtgacatgttTTG

    BH0303 Gene: BH0303     GI: 15612866     BI number: BH0303     GOG: COG0778     Description:            GC           A  A           A  G       CA           G  A      G  T   A        GC       A  C A  A       AT        TA G  A      C  A       CG A  G      A  C      A  A GC       G  A      G  A AT        GT        CG GC        GT        GC AT        GC        GC GC        CG        TG A  G      |  T       TA G  G      T  T       TG G  G      C  T       GC TG        TG        CG TA        CG        TA GC        GC        TA                         TGTTTTTTTCTTATGCATGGATCTTACGTTTTATAAGCAGTATTATTGAAAGTATATTTGAAAATGATTATCATTATTAAtaacgttttcgtaaatttggttgttctacatgaagccattgaatgacgaaaaaaggagtgacatgttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0778 Nitroreductase ... can be seen here     ..................................................................................................................