Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:48 nt.    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -6.20 kcal/mol
Antiterminator:    Distance from promoter:21 nt. Size=33 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=75 nt.     Delta G=-11.85 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATT-TATACT. It has a score value of 80.32 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATTTTCAAATGTACTTTGTCCTATACTAGTACTCATaggtagggcctctcctctcagttggtttagcg
gttaactagagggtaccctacctctttttttgattcaacgcctttacacaaactatcgtacatcatccaagcattatcccggatatgcaaaatacagcaa
cgggaaaatattcgccatccattttgtaaataatgattggaccATG

    BH0310


Gene: BH0310     GI: 15612873     BI number: BH0310     GOG: -------     Description:


  C
A  T
T  C
G  A
 AT
 Ta
 Cg
A  |
 Tg
 At
 Ta
 Cg
 Cg
 Tg
 Gc
T  c
T  t
T  c
C  t
A  c
T  c
G  t
T  c
A  |
A  |
A  |
C  |       ag
T  |      t  c
T  |      t  g
T  |      t  g
T  |       gt
 At        gt
 Gc        ta
 Ta        ta
 Tg        gc        cc
 At        at       a  c
 At       c  |      t  t
 Tg        ta       g  a
 Cg        cg        gc
T  |       ta        gc
 At        cg        at
 At        cg        gc
 Gt        tg        at
                        ttttttgattcaacgcctttacacaaactatcgtacatcatccaagcattatcccggatatgcaaaatacagcaacgggaaaatattcgccatccattttgtaaataatgattggaccATG


    ..................................................................................................................