                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:70 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G=-10.80 kcal/mol
Antiterminator:    Distance from promoter:73 nt. Size=44 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:    Distance from promoter:49 nt.    Size=31 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAC-TAAGAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAACCGAATCAATCGGGAGCTTAAGATCTCTCCTCCAGATGTGGAAATCTCCATTT
TTGAGACGTCAAAATATAACCGGGCATTAGGTGATTACCTAGGTATGAACGAACTTCA
ATGAttatgtagaggtaggaaggcggtcattcgtgactgtctcttctttatccaagtcgataaaagccgtttatgtcataatgagagggaatcactc
aatcagaggcaggtgatctcgATG

    BH0315 Gene: BH0315     GI: 15612878     BI number: BH0315     GOG: COG3910     Description:             g           t  t           a  a            tg            ta           A  g AT       G  g G  T      T  t TA       A  a GC       A  g GC        Cg AT        Ta TA        Ta        tc |  G       Cg       t  g |  G      A  g       at |  T      A  |       cg TA        Gc        ta AT        Cg        gc CG       A  g       gt G  A       At        cg G  A       Gc        gt GC        Ta        gc CG        At        at                         cttctttatccaagtcgataaaagccgtttatgtcataatgagagggaatcactcaatcagaggcaggtgatctcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3910 Predicted ATPase ... can be seen here     ..................................................................................................................