                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=62 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggaaatagacgaggtttaggtcgcactctatatgggtgcgtggattgaaattctaaatgattttaattgcacaaaaaagaccgagttgtcgcactctata
tgggtgcgtggattgaaatcttatgttttgctccatggtacggttgttgaatgtacctatcattcttttacacttattgtttagtaagttagctagtcaa
ctaacttactttgtttctagtcattttaaaaagataacaaatcagtaaaagccaccagtagacaacattcgaagcatcttttgaaaggagttactcccgc
ATG

    BH0353 --- BH0354 Gene: BH0353     GI: 15612916     BI number: BH0353     GOG: COG1309     Description: - Gene: BH0354     GI: 15612917     BI number: BH0354     GOG: -------     Description:             c           c  t           a  a           t  t            gc            ta            at            at            gc           |  t           |  t           |  t           t  t            ta            gc           t  |            ta            gc            gt           c  |            at        gt            ta       a  c            gt       t  a   t        gt       c  a g  t       tg        gc t  g       at        at t  a      c  t       ta g  a      c  t       ta gt        ta        gc cg        cg        at at        gt        at ta        ta        ta gc        ta        gc gc        tg        at                         ttgtttctagtcattttaaaaagataacaaatcagtaaaagccaccagtagacaacattcgaagcatcttttgaaaggagttactcccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1309 Transcriptional regulator ... can be seen here     ..................................................................................................................