                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAGAAGCTGCGCAAAGCTTAGGAGTTCCTGCGGCTAAGGCAGCGATGGCCGTTGCGT
GGGGAGATGCGTGGACGAATATGATTCAACCGTTTTGGGCGCTTCCCGCTCTTGCGAT
TGCTGGTTTGAAAGCGAAAGACATTATGGGCTTTTGCGTGATGATTTTAGTTGTGAGC
GGCGTAGTGATATCGCTCGGATTTTTGCTTATGTAAcaaaggttatgtgaactgtgtgagggaaatgaatcga
tccttacacagttttttcgtaaggattatgatcaatttgagattgaaacagtcATG

    BH0359 Gene: BH0359     GI: 15612922     BI number: BH0359     GOG: COG0454     Description:            aa TA       a  g A  T       cg GC        At TG        At GC        Ta         a AT        Gt       g  a T  |       Tg       t  t GC        At       a  c CG        Tg       a  g |  G       Ta       a  a |  A      C  a       gt |  T      G  c       gc |  T      T  t       gc |  T      T  |       at GT       T  |       gt GT       T  |       ta CG        Tg        gc GC        At        ta AT       G  g       gc GT        Gt        ta TA        Cg        cg GT        Ta        at                         tttttcgtaaggattatgatcaatttgagattgaaacagtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:100 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -8.20 kcal/mol Antiterminator: Size=46 nt.     Delta G= -9.10 kcal/mol Anti-antiterminator:   Size=22 nt.     Delta G= -4.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTAGAAGCTGCGCAAAGCTTAGGAGTTCCTGCGGCTAAGGCAGCGATGGCCGTTGCGT GGGGAGATGCGTGGACGAATATGATTCAACCGTTTTGGGCGCTTCCCGCTCTTGCGAT TGCTGGTTTGAAAGCGAAAGACATTATGGGCTTTTGCGTGATGATTTTAGTTGTGAGC GGCGTAGTGATATCGCTCGGATTTTTGCTTATGTAAcaaaggttatgtgaactgtgtgagggaaatgaatcga tccttacacagttttttcgtaaggattatgatcaatttgagattgaaacagtcATG     BH0359 Gene: BH0359     GI: 15612922     BI number: BH0359     GOG: COG0454     Description:             A           G  T           T  T            AT            GT            TA           G  |            CG            GT           |  T           T  G           T  T            TG            TA        GT TT        CG       A  G C  T       GC        TA G  T      |  G       GT G  G      G  G      C  A GC        GC       G  T TG        TG        GC AT        AT        CG TG        TA        GC TA        TG        AT AT        AT        GC CG        CG        TG                         GATTTTTGCTTATGTAAcaaaggttatgtgaactgtgtgagggaaatgaatcgatccttacacagttttttcgtaaggattatgatcaatttgagattgaaacagtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................