                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgtaagtttcgtatggatgaacgagttactaaagaatgatgatgacttatgcaaagtgagcatagagtgaggagggaacatagacaattaagctggtta
ttcctgttaaaagtaataaccttagacaaaattgtatcatttttaagaagtcggaccaaattaaatgcctcgtgtaatatcggagcataaaaaatcaata
gggaagcaacgaagcatagcctttatatggacacttgggttatgtggagctactagtgtaaccggccctcctttaacaataggagaggtgtctttttttt
ATG

    BH0361 --- BH0362 Gene: BH0361     GI: 15612924     BI number: BH0361     GOG: COG4932     Description: - Gene: BH0362     GI: 15612925     BI number: BH0362     GOG: COG3764     Description: tt c  g a  g cg at g  | gt ta at tg at tg tg ta c  | cg gc at |  a |  c |  t |  a tg at cg gt a  a a  a g  c       ac c  c      a  a a  g      t  a a  |      t  t cg        ta gc        cg |  c       cg a  c       ta at        cg gc       |  a gc        cg gt        cg at        gt             gtcttttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4932 Predicted outer membrane protein ... can be seen here [M] COG3764 Sortase (surface protein transpeptidase) ... can be seen here     ..................................................................................................................