                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGTAAGCCCCATTTATTAAAGGAAACCGCTCGCCATGTTCTTCCTTATTTGGCTTCA
GGGAAATTAAAGGTTCACATCGGTCATGAATATCGGCTGACGGATGCAGCAAACGCCC
ATCGATTAATGGAAAGTAGACTCAATAGAGGCAAGATTCTTTTGAACGTGGAGTAGgt
gagaaggggtgtgcaaaaaaagagcacacttctttttttatacaaaacaattgacgttctttgctaatgaatgtaatatatatattacatatgtaatgta
tatattgcatttatataggtgattgaATG

    BH0364 --- BH0365 Gene: BH0364     GI: 15612927     BI number: BH0364     GOG: COG1476     Description: transcriptional regulator Gene: BH0365     GI: 15612928     BI number: BH0365     GOG: NOG29512     Description:   A G  G GT TA G  G Cg         a At       a  a A  g      a  a G  a      a  g Tg       a  a Ta        cg Ta        gc Tg        ta Cg        gc Tg        ta Tg        gc At        gt G  g       gt A  |       gc At        at Cg        at Gc        gt             ttttatacaaaacaattgacgttctttgctaatgaatgtaatatatatattacatatgtaatgtatatattgcatttatataggtgattgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1476 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................