                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGGGCGGCTCGGATTATTTATTCAAAATGCTGGCTGGGTGGACCCAGGATTTAACG
GACAAATTACGCTTGAACTGTTTAATGCCAATCGCTTGCCCATCGAATTGCCGATCGG
ACGGAGGATTTGTCAGTTGGTGTTTGCAGAGGTAACGGGGGAAGTAGCACCGTATCAA
GGAAAGTACCTTTTTCAAAAAGGTGCGACCATGAGCGAAATTTACAAAGACGCGTTTT
AAtggtaatagagttcatttaggtgaactcttttttacgatcaggaaacaatgcgaaaggagaggaccATG

    BH0369 Gene: BH0369     GI: 15612932     BI number: BH0369     GOG: COG0822     Description: nitrogen fixation protei GC C  G AT GT AT AT |  A |  A |  t A  g Cg At Ta Ta T  t       ta A  a      t  g A  g       tg A  a       at G  |       cg Cg        ta Gt        ta At        gc Gc        at Ta        gc At        at             tttttacgatcaggaaacaatgcgaaaggagaggaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0822 NifU homolog involved in Fe-S cluster formation ... can be seen here     ..................................................................................................................