                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -4.11 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTAGCCAAGCTGGCCAAGATCTTTGGCTATTATCGTTAAacgacactcgtttcctttgtgggaatgata
gacagatagaaagtgaccgtattaagataaagccatgtcagcgtttttgaatggtagaagctagctagacatgctttttttattaatcgtttacatcatc
tctggctacagaaaaagggagattaattgcttgaggaaatgaaaaggaaataatcagtcaacagggcgattgctaaaagggagcaatcgctatttttacg
tatacggagcactgaggaggggatggcctaATG

    BH0371 Gene: BH0371     GI: 15612934     BI number: BH0371     GOG: COG1164     Description:   a a  a g  t g  g a  a g  a ta ta cg g  g ta ta a  a at ta ta at gc a  | g  | g  | g  |                  a a  |                a  g a  |        c       a  g a  |      a  a      a  g a  |      a  g       ta a  |       cg        cg g  |       tg        gc a  |       gc        ta c  |      a  |       ta a  |       cg        at ta        ta        gc cg        at        cg gt        at        gc gc        tg        gt                         atttttacgtatacggagcactgaggaggggatggcctaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1164 Oligoendopeptidase F ... can be seen here     ..................................................................................................................