                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:151 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.20 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=28 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttt-ttaact. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttttatgagcgtgagtgttcttaactaatccgtaattggatacgtacgaatcggtaaaaaaatcgacatacacgtcggtttatttgtgctacctatt
cgtacgagttaagaaccgagcaatcattctaggcacccgtctgtctttattcggggtctattcaacgtaaagggcgaacgaacgcctcaagcgattgctt
gaggcgttttttgtgtacattttattacagaagggacgattctcgtcATG

    BH0376 Gene: BH0376     GI: 15612939     BI number: BH0376     GOG: COG1193     Description: DNA mismatch repair protei cg        at a  a      g  t a  a       cg gc        gc cg        at gc        at gc        cg gt        ta a  c       cg a  a       cg a  a       gc tg        cg gc        at cg        at             ttttgtgtacattttattacagaagggacgattctcgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1193 Mismatch repair ATPase (MutS family) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:151 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.20 kcal/mol Antiterminator:    Distance from promoter:117 nt. Size=28 nt.     Delta G= -8.40 kcal/mol Anti-antiterminator:    Distance from promoter:101 nt.    Size=29 nt.     Delta G= -9.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgttt-ttaact. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgttttatgagcgtgagtgttcttaactaatccgtaattggatacgtacgaatcggtaaaaaaatcgacatacacgtcggtttatttgtgctacctatt cgtacgagttaagaaccgagcaatcattctaggcacccgtctgtctttattcggggtctattcaacgtaaagggcgaacgaacgcctcaagcgattgctt gaggcgttttttgtgtacattttattacagaagggacgattctcgtcATG     BH0376 Gene: BH0376     GI: 15612939     BI number: BH0376     GOG: COG1193     Description: DNA mismatch repair protei ct t  t       at        at gt       t  t      g  t ta       c  c       cg c  t       ta        gc t  t       ga        at gc        gc        at cg        gg        cg cg        gt        ta cg       c  a       cg a  |      t  a       cg cg       t  a       gc gt        ag        cg gc        tg        at at        tg        at                         ttttgtgtacattttattacagaagggacgattctcgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1193 Mismatch repair ATPase (MutS family) ... can be seen here     ..................................................................................................................